Effect of IMPDH1 knockdown on biological behavior of human colon cancer SW480 and HT29 cells

doi:10.3877/cma.j.issn.1674-0785.2023.08.007

Abstract

Abstract:

Objective

To investigate the effect of IMPDH1 knockdown on the biological behavior of human colon cancer SW480 and HT29 cells.

Methods

The expression of IMPDH1 gene in the human normal colon mucosal cell line FHC and the human colon cancer cell lines SW480 and HT29 was detected by qRT-PCR. Small interfering RNAs (siRNAs) was used to knock down the expression of IMPDH1 in SW480 and HT29 cells, and the mRNA and protein expression levels of IMPDH1 in SW480 and HT29 cells were detected by qRT-PCR and Western blot, respectively, to verify the transfection effects. MTT, Transwell, and scratch healing assays were performed to detect the effects of IMPDH1 gene knockdown on the proliferation, invasion, and migration of SW480 and HT29 cells.

Results

IMPDH1 was expressed in FHC, SW480, and HT29 cells, and the expression of IMPDH1 in SW480 and HT29 cells was higher than that in FHC cells. After siRNA transfection of SW480 and HT29 cells, the mRNA and protein expression levels of IMPDH1 were significantly reduced compared with those of the control group (P＜0.05). MTT assay showed that IMPDH1 knockdown inhibited the proliferation of SW480 and HT29 cells in vitro (P＜0.01). Transwell assay showed that IMPDH1 knockdown inhibited the invasiveness of SW480 and HT29 cells in vitro (P＜0.05). The scratch healing assay showed that IMPDH1 knockdown inhibited the migration ability of SW480 and HT29 cells (P＜0.05).

Conclusion

IMPDH1 expression in SW480 and HT29 cells is higher than that in FHC cells. IMPDH1 could inhibit the proliferation, invasion, and migration of SW480 and HT29 cells in vitro.

Key words: Colorectal cancer, IMPDH1, Gene expression, Biological behavior

Feifei Wang, Guanglin Wang, Zesong Meng, Baokun Li, Longfei Cao, Juan Zhang, Chaoxi Zhou, Yuanyi Ding, Guiying Wang. Effect of IMPDH1 knockdown on biological behavior of human colon cancer SW480 and HT29 cells[J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(08): 884-890.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhlcyszz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.1674-0785.2023.08.007

https://zhlcyszz.cma-cmc.com.cn/EN/Y2023/V17/I08/884

Figures/Tables 9

References 24

1	贾宏伟, 熊智灵, 程卯生, 等. 具有抗肿瘤活性的次黄嘌呤核苷酸脱氢酶抑制剂的研究进展 [J]. 中国药物化学杂志, 2021, 31(11): 901-910.
2	Zou J, Han Z, Zhou L, et al. Elevated expression of IMPDH2 is associated with progression of kidney and bladder cancer [J]. Med Oncol, 2015, 32(1): 373-384.
3	He Y, Zheng Z, Xu Y, et al. Over-expression of IMPDH2 is associated with tumor progression and poor prognosis in hepatocellular carcinoma [J]. Am J Cancer Res, 2018, 8(8): 1604-1614.
4	Xu Y, Zheng Z, Gao Y, et al. High expression of IMPDH2 is associated with aggressive features and poor prognosis of primary nasopharyngeal carcinoma [J]. Sci Rep, 2017, 7(1): 745-754.
5	Duan S, Huang W, Liu X, et al. IMPDH2 promotes colorectal cancer progression through activation of the PI3K/AKT/mTOR and PI3K/AKT/FOXO1 signaling pathways [J].J Exp Clin Cancer Res, 2018, 37(1): 304-315.
6	Li HX, Meng QP, Liu W, et al. IMPDH2 mediate radioresistance and chemoresistance in osteosarcoma cells [J].Eur Rev Med Pharmacol Sci, 2014, 18(20): 3038-3044.
7	Wang G, Wang F, Shan B et al. Uncovering potential genes in colorectal cancer based on integrated and DNA methylation analysis in the gene expression omnibus database [J]. BMC Cancer, 2022, 22(1): 138-139.
8	Cuny GD, Suebsuwong C, Ray SS. Inosine-5'-monophosphate dehydrogenase (IMPDH) inhibitors: a patent and scientific literature review (2002-2016) [J]. Expert Opin Ther Pat, 2017, 27(6): 677-690.
9	Carcamo WC, Satoh M, Kasahara H, et al. Induction of cytoplasmic rods and rings structures by inhibition of the CTP and GTP synthetic pathway in mammalian cells [J]. PLoS One, 2011, 6(12): e29690.
10	Hager PW, Collart FR, Huberman E, et al. Recombinant human inosine monophosphate dehydrogenase type I and type II proteins. Purification and characterization of inhibitor binding [J]. Biochem Pharmacol, 1995, 49(9): 1323-1329.
11	Wu Y, Wei X, Feng H, et al. An eleven metabolic gene signature-based prognostic model for clear cell renal cell carcinoma [J]. Aging (Albany NY), 2020, 12(22): 23165-23186.
12	Ruan H, Song Z, Cao Q, et al. IMPDH1/YB-1 positive feedback loop assembles cytoophidia and represents a therapeutic target in metastatic tumors [J]. Mol Ther, 2020, 28(5): 1299-1313.
13	Jia X, Liu Y, Cheng Y, et al. Inosine monophosphate dehydrogenase type1 sustains tumor growth in hepatocellular carcinoma [J].J Clin Lab Anal, 2022, 36(5): e24416.
14	Braun-Sand S B, Peetz M. Inosine monophosphate dehydrogenase as a target for antiviral, anticancer, antimicrobial and immunosuppressive therapeutics [J]. Future Medicinal Chemistry, 2010, 2(1): 81-92
15	Petrelli R, Vita P, Torquati I, et al. Novel inhibitors of inosine monophosphate dehydrogenase in patent literature of the last decade [J]. Recent Pat Anticancer Drug Discov, 2013, 8(2): 103-125.
16	Keppeke GD, Andrade LEC, Barcelos D, et al. IMPDH-based cytoophidium structures as potential theranostics in cancer [J].Mol Ther, 2020, 28(7): 1557-1558.
17	Tong X, Smith J, Bukreyeva N, et al. Merimepodib, an IMPDH inhibitor, suppresses replication of Zika virus and other emerging viral pathogens [J]. Antiviral Res, 2018, 9(14): 34-40.
18	Vanderlinden E, Marchand A, Van Berwaer R, et al. A broad influenza virus inhibitor acting via IMP dehydrogenase and in synergism with ribavirin [J]. Antiviral Res, 2021, 6(19): 105208-105209.
19	Mody K, Baldeo C, Bekaii-Saab T. Antiangiogenic therapy in colorectal cancer [J]. Cancer J, 2018, 24(4): 165-170.
20	Bhattacharya R, Fan F, Wang R, et al. Intracrine VEGF signalling mediates colorectal cancer cell migration and invasion [J]. Br J Cancer, 2017, 117(6): 848-855.
21	Ferreira PCL, Thiesen FV, Pereira AG, et al. A short overview on mycophenolic acid pharmacology and pharmacokinetics [J]. Clin Transplant, 2020, 34(8): e13997.
22	Chong CR, Qian DZ, Pan F, et al. Identification of type 1 inosine monophosphate dehydrogenase as an antiangiogenic drug target [J]. J Med Chem, 2006, 49(9): 2677-2680.
23	Valvezan AJ, McNamara MC, Miller SK, et al. IMPDH inhibitors for antitumor therapy in tuberous sclerosis complex [J]. JCI Insight, 2020, 5(7): e135071.
24	Keppeke GD, Andrade LEC, Barcelos D, et al. IMPDH-Based Cytooph- idium Structures as Potential Theranostics in Cancer [J]. Mol Ther, 2020, 28(7): 1557-1558.

siRNA	Sequences 5'-3'
si1224	GCUGCCUAUCGUCAAUGAU
	AUCAUUGACGAUAGGCAGC
si2048	UGUACUCAGGAGAGCUCAA
	UUGAGCUCUCCUGAGUACA
NC	CUUACGCUGAGUACGUCGA
	UCGAAGUACUCAGCGUAAG

siRNA	Sequences 5'-3'
si1224	GCUGCCUAUCGUCAAUGAU
	AUCAUUGACGAUAGGCAGC
si2048	UGUACUCAGGAGAGCUCAA
	UUGAGCUCUCCUGAGUACA
NC	CUUACGCUGAGUACGUCGA
	UCGAAGUACUCAGCGUAAG

Internal reference and primer	Sequences 5'-3'
GAPDH-F	GGAGCGAGATCCCTCCAAAAT
GAPDH-R	GGCTGTTGTCATACTTCTCATGG
IMPDH1-F	TGAAGAAGAACCGAGACTACCC
IMPDH1-R	TCCAGACGGTATTTGTCATCCT

Internal reference and primer	Sequences 5'-3'
GAPDH-F	GGAGCGAGATCCCTCCAAAAT
GAPDH-R	GGCTGTTGTCATACTTCTCATGG
IMPDH1-F	TGAAGAAGAACCGAGACTACCC
IMPDH1-R	TCCAGACGGTATTTGTCATCCT

[1]	Li Dai, Huiwei Deng, Huajing Guo, Furong Huang. Effect of continuous infusion of esketamine on postoperative sleep quality of patients undergoing laparoscopic colorectal cancer surgery [J]. Chinese Archives of General Surgery(Electronic Edition), 2023, 17(06): 408-412.
[2]	Guobing Peng, Jianping Fei. Influence of permanent colostomy on colostomy patient's status and its influencing factors [J]. Chinese Journal of Hernia and Abdominal Wall Surgery(Electronic Edition), 2023, 17(03): 264-268.
[3]	Xiaomei Liu, Lu Zhang, Xu Liu, Die Liang. Effects of miR-127-3p targeting macrophage migration inhibitory factor on the biological behavior of human renal cancer cells [J]. Chinese Journal of Cell and Stem Cell(Electronic Edition), 2023, 13(02): 76-83.
[4]	Runzhi Chen, Dongmei Yang, Huiting Xu. PD-1 combined with surufatinib for the treatment of metastatic colon cancer with microsatellite stability and BRAF V600E mutation: A case report and review [J]. Chinese Journal of Colorectal Diseases(Electronic Edition), 2023, 12(05): 431-435.
[5]	Yimin E, Sizheng Sun, Xiaoyu Fan, Chunzhao Yu. Present status and prospect of fecal screening for colorectal cancer [J]. Chinese Journal of Colorectal Diseases(Electronic Edition), 2023, 12(04): 331-336.
[6]	Wenlong Liang, Jie Cao, Qing Huang, Yong Lin, Hongli Huang, Ping Yang, Guanwei Li, He Hu. Efficacy and safety analysis of sintilimab combined with regofenib in the treatment of advanced colorectal cancer [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2023, 13(06): 409-413.
[7]	Xiaona Wang, Wei Tan, Yue Li, Wenyan Jiang. Effects of predictive care on perioperative quality of life, mood, and complication in patients undergoing radical colorectal cancer surgery [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2023, 13(06): 525-529.
[8]	Daijiang Liu, Junyan Jiang, Xiaoqiang Wan, Shaying Ma. Analysis of survival status and prognostic factors in patients with colorectal cancer with liver metastasis [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2023, 13(05): 284-288.
[9]	Jian Wang, Haijian Zhao, Jing Sun, Xiaoyu Zhang, Baiyu Chen. Relationship between LncRNA SNHG4 expression and prognosis of colorectal cancer [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2023, 13(03): 139-144.
[10]	Yongsheng Li, Jiahe Sun, Shuwei Guo, Yikang Lu, Hongzhou Liu. Short-term postoperative complications and their influencing factors in elderly patients with colorectal cancer [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(9): 962-967.
[11]	Fanbiao Kong, Jianrong Yang. Progress in understanding of relationship between underlying liver diseases and liver metastasis of colorectal cancer [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(07): 818-822.
[12]	Yadan Wang, Jing Wu, Boyang Huang, Miaomiao Wang, Chunmei Guo, Hui Su, Canghai Wang, Jing Wang, Pengpeng Ding, Hong Liu. Design and validation of white-light endoscopy model for predicting the nature of colorectal tumors [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(06): 655-661.
[13]	Yanzhao Wang, Pengfei Niu, Changmin Ding, Qingkun Gao, Zhaoya Gao, Ke An, Zhichao Zhai, Qingmin Zeng, Wensheng Zeng, Fuming Lei, Jin Gu. Primary repair of large abdominal wall defect caused by colorectal cancer: our experience with 13 cases [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(05): 557-561.
[14]	Pengtao Ren, Yinghao Hao, Hongxun Ruan, Xiaoning Qin, Yuan Zhang, Meng Li. Lnczc3h7a inhibits proliferation and migration of intestinal cancer cells by targeting CTHRC6 [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(03): 320-325.
[15]	Wenjun Deng, Changzheng Li. Progress on the use of intestinal cleaning agents before colonoscopy [J]. Chinese Journal of Gastrointestinal Endoscopy(Electronic Edition), 2023, 10(03): 192-194.

Please choose a citation manager

Content to export